dimanche 1 mars 2015

how to, if possible, set the stringtokenizer's delimiter so that it breaks any given text into units with a given character length

I have this sequence "ggtacctcctacgggaggcagcagtgaggaattttccgcaatgggcgaaagcctgacgga" and I want to know how to break it into 3char length units like ggt acc tcc ..ect?


Aucun commentaire:

Enregistrer un commentaire